Updated November 27, 2024:
Mid-year report for North Dakota Soybean Council (July 1, 2024, to November 30, 2024)
a. Research Project Title, Principal and Co-Investigators
Title: Biology and Managing Seedling Pathogens in North Dakota
Principal Investigator: Febina Mathew (North Dakota State University, Department of Plant Pathology
Co-Investigators: Joao Paulo Flores and Nitha Rafi
b. Research Overview and Objectives
Soybean (Glycine max L.) seedling pathogens represent a significant constraint to crop production and yield in the United States. According to the soybean disease survey conducted in 2023, Fusarium emerged as one of the most prevalent groups of pathogens infecting soybean roots during the seedling growth stage. Given the diversity of seedling pathogens affecting soybeans and the presence of favorable environmental conditions—such as wet soil and lower soil temperatures at planting—there is a pressing need for improved management strategies for farmers. A comprehensive understanding of the effectiveness of seed treatment fungicides against seedling pathogens, as well as host resistance, is imperative. Currently, there is a lack of sufficient data regarding the distribution of major seedling pathogens that infect soybeans in North Dakota. Although seed treatment fungicides are available to manage sudden death syndrome (SDS) caused by F. virguliforme to some extent, the impact of these products on Pythium, a significant seedling pathogen of soybean, remains inadequately understood. Consequently, this study aims to achieve the following objectives: (1) to investigate the distribution of microbial genera, including seedling pathogens associated with soybean roots in North Dakota; (2) to assess the impact of seed treatment on Pythium; and (3) to evaluate soybean accessions for resistance to Rhizoctonia solani and Pythium sp. The information derived from these studies will assist North Dakota farmers in more effectively managing seedling diseases caused by Fusarium, Rhizoctonia solani, and Pythium sp.
c. Completed Work: Deliverables and/or Milestones.
• Fusarium was identified as the most dominant genus infecting soybean roots in North Dakota, followed by Rhizoctonia and Macrophomina.
• Sudden death syndrome (SDS) was confirmed in two new ND counties, Cass and Dickey, in 2024, in addition to Richland County, where the disease was first observed in the state
• A 4% to 12% increase in the number of emerged plants was observed with the use of seed treatments against Pythium when compared to the non-inoculated control
• An article was published titled “Sudden Death Syndrome Identified in Soybean Fields Across Eastern North Dakota” in the North Dakota Soybean Grower Magazine for the December 2024 issue. Link - https://ndsoybean.org/wp-content/uploads/2024/11/Soybean_Grower_Magazine_Volume_13_Issue_6_-_WEB.pdf
d. Progress of Work and Results to Date
Objective 1. Characterize the species distribution of seedling pathogens associated with soybeans. (Objective in progress)
Mathew's lab conducted a soybean disease survey across 17 counties in North Dakota (Fig. 1), assessing 102 fields (ranging from 2 to 13 fields per county) during the vegetative or reproductive growth stages of soybean. Soil and infected plant samples were collected from each plot to study seedling pathogens (Fig. 2) and the occurrence of sudden death syndrome (SDS). Soil samples were taken from five random locations in each field, following a 'W' pattern. These five samples were mixed homogeneously to create a single composite sample representing each field.
Diseased plants exhibiting characteristic root rot symptoms—such as brown to black root lesions, collar rot, and reddish discoloration on the roots—were collected from 80 fields to investigate various seedling pathogens (Fig. 2).
For fungal isolation from the soil, roots from 7-day-old pre-germinated seedlings were placed in 20 grams of homogenized and sieved soil from each field using a rolled paper towel assay. The soybean accessions used included USDA varieties PI 561242, PI 437295, PI 468904, PI 437238, PI 243547, PI 347565B, PI 248403, PI 189866, PI 154196, PI 548504, PI 548398, PI 181536, and PI 639740. Six replications were maintained for each field, and the seedlings were incubated at 22 ± 3°C with a moisture level at 60 percent water holding capacity. After 10 days of incubation, the infected root bits were surface sterilized, blotted dry, and plated on antibiotic-amended (0.06% streptomycin sulfate) quarter-strength potato dextrose agar (PDA) media. Fungal colonies were purified using the hyphal tipping method and transferred to full-strength PDA plates for cultural and morphological characterization. The isolates were incubated at 22 ± 2°C and identified at the genus level based on morphological characteristics.
A total of 458 fungal isolates were recovered from the diseased soybean roots inoculated with soil from 80 fields. Seven fungal genera were morphologically identified, including Alternaria, Cladosporium, Fusarium, Penicillium, Macrophomina, Rhizoctonia, and Rhizopus. The most predominant genus was Fusarium, which accounted for 84 percent of the total recovered isolates from the field soil (Fig. 3 and Fig. 4). Among the identified genera, Fusarium and Rhizoctonia are recognized as established seedling pathogens of soybeans.
A total of 22 commercial fields were surveyed for the presence of sudden death syndrome (SDS) (Fig. 5) across four counties: Richland, Cass, Traill, and Dickey. Additionally, Mathew’s laboratory received nine plant samples suspected of SDS (from Richland, Cass, and Dickey counties) from the Plant Diagnostic Lab (Table 1: Samples Oakes 1 to Wb) at North Dakota State University (NDSU). These plants displayed symptoms of SDS, including foliar chlorosis, necrosis, cupping/curling of leaves, severe defoliation, brown discoloration on the lower stem, and white pith with bluish spore mass on the taproot when split open, were collected from 22 fields.
We extracted DNA from the suspected plant samples (specifically roots) and conducted a quantitative polymerase chain reaction (qPCR) assay utilizing Fusarium virguliforme-specific primers (forward primer: 5’ GTAAGTGAGATTTAGTCTAGGGTAGGTGAC 3’; reverse primer: 5’ GGGACCACCTACCCTACACCTACT 3’) and probe (6FAM-TTTGGTCTAGGGTAGGCCG-MGBNFQ), as described in the study by Wang et al. (2014). The positive control employed was the genomic DNA of F. virguliforme, while nuclease-free water served as the negative control. Each reaction comprised a total volume of 20 µl, consisting of 10 µl of TaqMan Universal Master Mix II, 0.4 µl of 10 µM forward primer, 0.4 µl of 10 µM reverse primer, 0.2 µl of 10 µM probe, 2.0 µl of DNA template, and 7.0 µl of autoclaved water. The thermal cycling conditions employed were as follows: initial denaturation at 95°C for 3 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds, and annealing/extension at 60°C for 1 minute. The qPCR amplifications were conducted using the QuantStudio 3 real-time qPCR machine (Applied Biosystems), and the cycle threshold (Ct) values were analyzed using QuantStudio Design and Analysis software, version 1.5.2. Among the 22 fields surveyed for SDS, nine fields were identified as suspected based on the qPCR assay results (Table 1). A Ct value of less than 30 for a sample was considered positive for SDS, and the field was suspected of having SDS, while values exceeding 30 were considered negative for the samples and the fields. Of the nine samples received from the Plant Diagnostic Lab, six were classified as SDS suspects according to the corresponding Ct values (Table 1). We successfully isolated Fusarium virguliforme from the plant samples exhibiting positive Ct values and confirmed the molecular identity of a total of 28 suspected isolates by qPCR, using DNA extracted from the fungal cultures as previously described. Our study shows that SDS is expanding into new counties where it had not been previously reported. After being documented in Richland (2018) and Cavalier (2020), the disease was identified in Cass and Dickey Counties in 2024 (Figure 5). In 2024, SDS was confirmed in Richland, Cass, and Dickey Counties through the isolation of Fusarium virguliforme from diseased plant samples collected randomly from affected fields. The identity of the organism was confirmed using molecular assays (Wang et al. 2015).
Table 1. Details of fields surveyed in 2024 for SDS (A Ct value of less than 30 for a sample was considered positive for SDS, and the field was suspected of having SDS, while values exceeding 30 were considered negative for the samples and the fields.)
FieldID County Latitude Longitude Growth stage of soybean Ct value (From suspected Plant DNA) SDS Field incidence (%) Fusarium virguliforme isolated and ID confirmed by qPCR?
P2 Richland 46.15245 -96.80942 R5 27.82 20 Yes
P3 Richland 46.15216 -96.79019 R5 28.30 15 Yes
P6 Richland 46.26053 -96.78165 R5 26.16 60 Yes
R7 Richland 46.262456 -96.86613 R6 26.94 5 Isolated, awaiting confirmation by qPCR
R8 Richland 46.262664 -96.86549 R6 25.70 10 Yes
R9 Richland 46.261958 -96.943551 R6 24.82 10 Yes
R10 Richland 46.262014 -97.031583 R6 34.32 No; the field was a false positive
C3 Cass 46.660001 -96.841282 R6 27.52 < 5 No
C4 Cass 46.674271 -96.841396 R6 26.12 < 5 No
C6 Cass 46.694705 -96.841066 R6 26.28 < 5 Isolated, awaiting confirmation by qPCR
TB1 Dickey 33.11 No; the field was a false positive
Oakes1 Dickey 22.87 Yes
Oakes3 Dickey 23.39 Yes
Oakes4 Dickey 24.63 Yes
Oakes2 Dickey Undetermined No
Oakes5 Dickey 33.66 No; the field was a false positive
1 Richland 24.58 Yes
1 Cass 28.48 No
2 Cass 29.24 No
Wb - 32.12 No; the field was a false positive
P1 Richland 46.153581 -96.88323 R5 0 No
P4 Richland 46.15228 -96.77705 R5 0 No
P5 Richland 46.26087 -96.81496 R5 0 No
A1 Cass 47.04373 -96.940439 R3-R4 0 No
A2 Cass 47.23882 -96.997039 R3-R4 0 No
A3 Traill 47.345589 -97.041466 R7 0 No
A4 Traill 47.381875 -97.054796 R7 0 No
C1 Cass 46.65902 -96.82561 R6 0 No
C2 Cass 46.659586 -96.825808 R6 0 No
C5 Cass 46.684257 -96.841341 R6 0 No
C7 Cass 46.712743 -96.862625 R6 0 No
Objective 2. Determine the effectiveness of fungicide seed treatments against Pythium. (Objective completed, the trial compromised by herbicide application)
The trial was established at North Dakota State University’s Main Research Station in Fargo, ND, following complete tillage (planted on 6/10/2024). The experimental design employed was a randomized complete block design, incorporating six treatments: a non-treated control, Acceleron (comprised of Prothioconazole, penflufen, metalaxyl, and imidacloprid), Intego Suite (containing Ethaboxam, ipconazole, metalaxyl, and clothianidin), Zeltera Suite (composed of Ethaboxam, fludioxonil, metalaxyl-M, clothianidin, and Inpyrfluxam), Cruiser Maxx Vibrance (which includes Mefenoxam, thiamethoxam, fludioxonil, and sedaxane), and Cruiser Maxx APX (Vayantis) (consisting of Mefenoxam, thiamethoxam, fludioxonil, sedaxane, and picarbutrazox). Each treatment was replicated four times. Each plot measured 20 ft in length and comprised four rows with a row spacing of 15 inches. The seeding rate was set at 104,000 plants per acre. The trial was inoculated with a North Dakota isolate of Pythium ultimum (provided by Webster Lab) using infested wheat seeds at a rate of 120 grams per plot at the time of planting. Two weeks post-planting (06/27/2024), the trial was treated with post-emergence herbicides, specifically Liberty (glufosinate) and Select Max (clethodim). Plant emergence was assessed three weeks after planting (07/01/2024), and the number of emerged plants was compared with the non-treated control plots using ANOVA analysis. A significant effect of treatments was not observed on the number of emerged plants (P > 0.05). As presented in Table 3, there were no significant differences in the number of emerged plants; however, a 4% to 12% increase in the number of emerged plants was observed with the use of seed treatments against Pythium when compared to the non-inoculated control.
Table 3. Effect of fungicide seed treatments against Pythium in Fargo, ND
Treatments Plants per acre
Non-Treated 61855.2 a
Acceleron 71002.8 a
Intego Suite 69260.4 a
Zeltera Suite 66211.2 a
Cruiser Maxx APX (Vayantis) 65993.4 a
Cruiser Maxx Vibrance 64686.6 a
P value 0.571
e. Work to be Completed.
Objective 1. Screen soybean accessions for resistance to Rhizoctonia solani and Globisporangium ultimum (formerly Pythium ultimum)
Mathew’s lab will screen 200 accessions of soybean obtained from USDA germplasm collection for resistance to Rhizoctonia solani and Globisporangium ultimum.
f. Other relevant information: potential barriers to achieving objectives, risk mitigation strategies, or breakthroughs.
Mathew’s lab was unable to complete the seed treatment trial for Pythium due to damage caused by the application of post-emergence herbicides (Fig. 6). As a result, the study was terminated.
g. Summary
A soybean disease survey conducted in the eastern region of North Dakota in 2024, encompassing 80 fields across 17 counties, revealed that the genus Fusarium was the predominant pathogen identified among seedling pathogens. Furthermore, sudden death syndrome (SDS) was confirmed in two new counties within North Dakota, specifically Cass and Dickey, in addition to Richland County, where the disease was first observed in the state. Several contributing factors, including increased precipitation levels in the southeastern states, minimal or no-tillage practices, cool and wet soil conditions, and the susceptibility of the host plant, may have facilitated the prevalence and spread of SDS, which was predominantly observed during the reproductive stages of the crop in the southeastern counties of North Dakota. A field trial was established to evaluate the effectiveness of various seed treatments (Acceleron, Intego Suite, Zeltera Suite, Cruiser Maxx APX [Vayantis], and Cruiser Maxx Vibrance) against Pythium in Fargo, North Dakota. Although no significant differences (P > 0.05) were observed in the number of emerged plants, a 4% to 12% increase in the number of emerged plants was noted with the application of seed treatments against Pythium, compared to the non-inoculated control.
View uploaded report 