2022
Effects of Increased Atmospheric CO2 and Abiotic Stress on Soybean Performance in the Enviratron
Contributor/Checkoff:
Category:
Sustainable Production
Keywords:
GeneticsGenomics
Parent Project:
This is the first year of this project.
Lead Principal Investigator:
Asheesh Singh, Iowa State University
Co-Principal Investigators:
Project Code:
GR-024750-00003
Contributing Organization (Checkoff):
Institution Funded:
Brief Project Summary:
Soybeans can adapt to stressful growing conditions, but environmental stress could increase, based on predictions about changing climate patterns. That raises questions about how soybeans may need to adapt in future production environments. This research is investigating how heat stress impacts soybean growth at a molecular level both above and below ground. It includes a focus on how heat directly impacts gene expression, or how genetics translate into plant functions, in different soybean varieties. The project also looks at how heat affects the soil microbiome, which in turn influences soybean growth. The objectives include understanding the role of native soil microbes in heat tolerance adaptation in soybeans and develop an understanding of key genes, metabolites and root anatomical traits in soybeans for high temperature stress.
Key Beneficiaries:
#applied researchers, #farmers
Unique Keywords:
#breeding, #breeding & genetics, #genetics, #heat, #soil health, #stress tolerance
Information And Results
Project Summary

The goals of this project are to investigate the performance of soybean under future climate scenarios with respect to disease development and abiotic stress tolerance. The long-term goal of this research is to inform forward-looking breeding approaches to develop soybean germplasm well-suited for future production environments.

Project Objectives

Objectives:
1. Study of the effects of CO2 on soybean responses to pathogens in the Enviratron. (Leads: Whitham, S.A. and Tang, L.)
2. Effects of elevated ambient temperatures on soybean gene expression in the Enviratron. (Lead: Singh, A.K.)
a. Understand the role of native soil microbes in heat tolerance adaptation in soybean
b. Develop an understanding of key genes, metabolites, and root anatomical traits in soybean for high temperature stress

Project Deliverables

1. Understanding of how increased atmospheric CO2 affects development of diseases caused by viruses, bacteria, and fungi in soybean.
2. Image analysis approaches for automated detection of diseased and heat stressed soybean plants.
3. Heat tolerance screening protocols will be streamlined
4. 2-3 open access journal publications will be developed by the end of second year of this project that will report on the key genes, metabolites, and root anatomical traits in heat stress.

Progress Of Work

Updated February 28, 2023:
3) Progress Update (what steps have been taken/initial set up or early findings)

Objective 1: Study of the effects of CO2 on soybean responses to pathogens in the Enviratron.
For all experiments, conditions were used that simulate an average mid-June day in Iowa with either 419 ppm or 550 ppm CO2, and soybean cultivar Williams 82 was used for all experiments.

a. Establish baseline physiology of soybean plants growing at 419 ppm versus 550 ppm CO2 in Enviratron growth chambers.
i. shoot biomass (wet and dry)
ii. plant height
iii. stomatal conductance (gas exchange occurring through leaf stomata)
iv. stomatal density (number of stomata per unit leaf area)
v. stomatal aperture (width of stomatal opening)
vi. photosynthetic activity
vii. RNA sequencing to determine effects of elevated CO2 on soybean gene expression. We are particularly interested in the effects of elevated CO2 on the expression of defense-related genes. RNA was extracted from plants and submitted to the ISU DNA Facility for sequencing. Data analysis is in progress.

For this objective, most data have been collected and analyses are in progress. In general terms, we find that plants grown under 419 ppm and 550 ppm CO2 are responding as we expect based on the literature. Plants grown at the higher CO2 level develop more biomass, are taller, and have greater photosynthetic activity at 35 days after sowing. In contrast, stomatal conductance and stomatal density is reduced. Stomatal aperture measurements are in progress.


b. Determine effects of elevated CO2 on five different pathogens interacting with soybean
i. Bean pod mottle virus (BPMV, bean pod mottle)
ii. Soybean mosaic virus (SMV, soybean mosaic disease)
iii. Pseudomonas syringae pathovar glycinea (Psg, bacterial blight)
iv. Fusarium virguliforme (sudden death syndrome)
v. Pythium sylvaticum (damping off)
vi. response to flg22 elicitor. Flg22 is a small peptide that is used to trigger basic soybean immune responses.

For this objective, we spent significant time in the first year to establish inoculation conditions for Psg, F. virguliforme, P. sylvaticum, and the flg22 treatment under the required growth conditions. We also developed required inoculum for BPMV and SMV experiments, and a standard rub-inoculation procedure was used for these viruses. All inoculations have been performed and samples have been collected for all the treatments or is in the process of being collected in repeat experiments. We are in the middle of data analyses, so no final conclusions are presented here. Collected data include biomass, disease ratings over time and at experiment end points, and when possible quantification of the pathogen. In some experiments, we are also collecting RNA samples for virus quantification or analysis of soybean gene expression.

In general terms, young soybean plants appear to be more resistant to the bacterial pathogen, and we are trying to understand why this is the case, because there are at least two possibilities. The first is physical: there are fewer stomata and less stomatal conductance, which suggests that stomata are not open as wide at 550 ppm as at 419 ppm. Therefore, there are reduced sites for Psg to enter the plant. The second is that we also observed that flg22 and bacteria inoculation trigger a much stronger defense response in plants grown at 550 ppm CO2, which suggests enhanced defense to bacteria at the higher CO2 level. In contrast to bacteria, the plants grown at 550 ppm appear to develop disease faster when infected by SMV or BPMV. We are in the process of quantifying virus levels to determine if the viruses accumulate to higher levels in plants grown at 550 ppm. We are still analyzing data from the F. virguliforme and P. sylvaticum experiments.

Objective 2: Effects of elevated ambient temperatures on soybean gene expression in the Enviratron.
After thorough project planning, soil collection and preparation were started in the winter of 2021-2022. The initial experiment was planted in the Enviratron in April 2022, however due to soil compaction and drainage problems, this experiment had to be terminated within two of the planned five weeks. This resulted in another round of soil collection and preparation. A new experiment was planted in June 2022, and two of the four treatments were successfully sampled. During this time, visible symptoms of stress were noted in certain genotypes in the elevated temperature chambers (Fig. 1). The remaining two treatments could not be sampled due to sudden chamber malfunctions within the last days of the experiment. Because of this, the two treatments were planted again in July, and were successfully sampled five weeks later. Please see pictures below of sampling day (Fig. 2).

For our experiment, we have used four soybean genotypes (Williams 82, IAS 19C3, PI 639693, and PI 89008) with (non-autoclaved) and without (autoclaved) microbes under high (day: 38o C for 16 hrs and dark: 28o C for 8 hrs) and optimum (day: 28o C for 16 hrs and dark: 21o C for 8 hrs) temperatures with 60% relative humidity and current ambient CO2 levels (400 ppm). We collected tissues for DNA, RNA, root exudate, and anatomical studies. Figure 3 shows the autoclaved soil does not have any DNA in it, meaning a load of available microbes was negligible or not detected; we have confirmed the same with qPCR and soil respiration assays (Fig. 4). We have observed significant respiration differences between autoclaved and non-autoclaved soils; non-autoclaved soils showed a fourfold cumulative CO2 flux difference compared to autoclaved soils (Fig. 4). Autoclaving did not change the physical property of the soil (Table 1 and Fig. 5); however, it changed the chemical properties of the soil, the level of phosphorous, sulfur, and manganese were increased significantly, and zinc and iron levels were going down, and other factors were unaffected. We have observed significant nodulation in the optimum temperatures’ treatment with microbes (non-autoclaved soil) (Fig. 6). We are planning on performing the follow-up experiment for the same.

In August and September, DNA and RNA extractions were successfully completed for all treatments. Rhizosphere soil DNA was extracted using Qiagen’s DNeasy power soil kit. Following these extractions, much of the fall of 2022 was taken up with necessary quality control and standardization of the extracted DNA and RNA before submission for sequencing (Fig. 7). The high-quality DNA was used for 16S and ITS library preparation and MiSeq sequencing. For the bacterial 16S hypervariable region V4 and for the fungal ITS1 region, the primers 515F (GTGYCAGCMGCCGCGGTAA) and 806R (GGACTACNVGGGTWTCTAAT) and ITS1f (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) were used, respectively. Libraries were sequenced using paired end 250 cycle MiSeq (500 cycles total). DNA and RNA samples were submitted for sequencing in November, and sequencing was completed by the ISU DNA Facility in late December. Data is now in hand and preliminary data exploration has been started. After this, full data analysis will be completed, and preparation of a journal manuscript will begin.

Additionally, due to observations that were noted during the experiment, a small project was planned and completed as an undergraduate research project. This has allowed a student interested in pursuing plant breeding related research to gain some practical experience in research and start developing her own research skills. While this is not a specific goal of this project, being able to develop the next generation of scientists is always a benefit.

View uploaded report PDF file

Final Project Results

Updated February 25, 2025:
1) Conclusions (include observations, solutions, and/or is additional research warranted – limit of 200 words per bullet point)
• What new knowledge was developed/discovered in the research supported by the ISRC?
Soybean diseases can be affected by CO2 levels that are expected in the future - some may be unaffected or decrease in severity, whereas there is potential for others to increase in severity.
The defense responses of soybeans are affected by CO2 levels.
• What are practical applications of the research? How long?
The results of this research do not have immediate practical applications, but point to new research avenues for the future.
A lot of attention is focused on temperature and water availability, and rightfully so. However, this research demonstrates that elevated CO2 levels on their own may have impacts on plant diseases.
The outcomes warrant additional research 1) to further understand the mechanisms that underlie the altered susceptibility to pathogens in elevated CO2 conditions and 2) to determine if there are genetic factors that can be used to improve soybean resistance to pathogens in elevated CO2 environments.
Additional work is needed to understand how elevated CO2, temperature, and water availability interact to affect soybean performance.
• How might this new knowledge/discovery affect the success of positive impact for industry and/or farmers?
The knowledge provides insight into how soybeans are expected to perform in elevated CO2 environments.
The research results suggest that soybean defenses are likely to be altered in the future as CO2 levels continue to rise, which can affect disease development. This information demonstrates that efforts to genetically adapt soybeans to higher concentrations of CO2 in the atmosphere should include enhancing disease resistance under those conditions as well.

2) Supporting attachments: Publication of findings doi: 10.1111/nph.20364.

3) Other information you want to share (limit of 100 words)
Leveraged funding from the Plant Sciences Institute to complete the research project.
Data from this project was used in support of a successful USDA NIFA grant application titled: Machine Learning-Assisted Multimodal Chemical, Biological, Physiological Sensing For Assessing Multiplex Plant Stress States ($591,499)
On a different note, there were some difficulties in utilizing Enviratron rover to automate the image acquisition process, e.g., unreliable communications between the rover and chamber server, and maintenance and manipulation issues. To that end, an upgraded rover design has been developed to integrate an omnidirectional vehicle, a dual-arm configuration, and more capable imaging, ranging, and spectral sensors.

4) List conferences, publications, etc. in which this research was shared
Presented our research as a poster at the American Phytopathological Society meeting in August 2022, Pittsburgh, PA
Presented our research outcomes as a talk and poster at the International Society for Molecular Plant Microbe Interactions meeting in July 2023, Providence, RI
Presented our research at the ISU Research Day hosted by ISRC in 2024
Published the research results in a high-profile plant journal: Bredow, M., Khwanbua, E., Chicowski, A. S., Breitzman, M. W., Qi, Y., Holan, K. L., Liu, P., Graham, M. A., Whitham, S. A. (2025) Elevated CO2 alters soybean physiology and defense responses, and has disparate effects on susceptibility to diverse microbial pathogens. New Phytologist In press. doi: 10.1111/nph.20364.

5) Conclusions (include observations, solutions, and/or is additional research warranted – limit of 200 words per bullet point)
• What new knowledge was developed/discovered in the research supported by the ISRC?
o This research revealed the effect of heat stress and changes in the soil microbiome to the gene expression of soybean. We found that different genotypes have unique transcriptional responses to heat stress, but there are some conserved genes. We also found that the soil microbiome changes the expression to heat stress, and appears to alleviate some of the symptoms.
o Soil autoclaving impacts soil chemical properties, increasing phosphorus, sulfur, and manganese levels while decreasing zinc and iron.
o Autoclaved soil lacks detectable microbial DNA, confirmed through qPCR and soil respiration assays.
o Significant nodulation was observed at optimal temperatures in non-autoclaved soil treatments.
o Elevated temperatures significantly influenced microbial activity, root anatomy, and nodulation efficiency.
o High temperatures and autoclaving did influence the bacterial and fungal diversity and assembly.
o Experiments revealed the critical role of microbes in soybean growth and stress resilience.

• What are practical applications of the research? How long?
o The practical applications for this work would take many years still. These applications could be the identification of candidate genes for heat stress tolerance, which could then be bred into commercial cultivars with acceptable yield levels.
o Informing sustainable soil management practices to optimize microbial diversity to promote soil health in extreme temperatures.
o Data from this research can guide researchers, with immediate use in experimental designs for follow-up studies.

• How might this new knowledge/discovery affect the success of positive impact for industry and/or farmers?
o The knowledge gives us greater insight in how soybean adapts to heat stress, and how it can continue to thrive. This opens opportunities for further research into specific molecular pathways and genes to be used to develop heat tolerant soybean. This is further coupled with the evidence that the soil microbiome contributes to the heat stress response, and can aid in alleviating the stress.
o Promotes better soil management practices, leveraging microbes for improved crop health and productivity.
o Provides a framework for integrating microbial health into agricultural practices, benefiting farmers facing heat stress challenges.
o Fostering collaboration with industry partners to understand microbial-soil-plant interactions, for driving innovations in crop production and sustainability.

6) Supporting attachments: see attached pdf to view supporting images

7) List conferences, publications, etc. in which this research was shared
a. ASA-CSSA-SSSA Annual Meeting (October 30, 2023)
b. R.F. Baker Plant Breeding Symposium (March 22, 2024)
c. Presented our research outcomes in ASA-CSSA-SSSA meeting in 2023
d. Showcased our research in the ISU Research Day hosted by ISRC 2024
e. Presented our research at the International Phytobiomes Conference 2024
f. Published a bioRxiv pre-print (https://doi.org/10.1101/2024.11.04.620947)
g. Peer-reviewed papers (2) are under development

View uploaded report PDF file

o The knowledge gives us greater insight in how soybean adapts to heat stress, and how it can continue to thrive. This opens opportunities for further research into specific molecular pathways and genes to be used to develop heat tolerant soybean. This is further coupled with the evidence that the soil microbiome contributes to the heat stress response, and can aid in alleviating the stress.
o Promotes better soil management practices, leveraging microbes for improved crop health and productivity.
o Provides a framework for integrating microbial health into agricultural practices, benefiting farmers facing heat stress challenges.
o Fostering collaboration with industry partners to understand microbial-soil-plant interactions, for driving innovations in crop production and sustainability.

Benefit To Soybean Farmers

A greater understanding of how increased atmospheric CO2 affects development of diseases caused by viruses, bacteria, and fungi in soybean will provide insight into future disease management scenarios. A greater understanding of the genetics for heat stress tolerance in soybeans will allow breeders to develop soybean varieties that can withstand these temperatures. The work in these two objectives will benefit future farmers as it ensures that they can maintain or increase their yields even in more adverse and different conditions expected in the future.

The United Soybean Research Retention policy will display final reports with the project once completed but working files will be purged after three years. And financial information after seven years. All pertinent information is in the final report or if you want more information, please contact the project lead at your state soybean organization or principal investigator listed on the project.